Kindred Hearts Mlm

Find your kindred spirits! There are many ways to sell your collection: online, at a garage sale, or through an auction house or flea market. See any money you make as a bonus as you part with your collection. Even if the collection has decreased in monetary value, the sentimental value may be equally important to the new owner.

kindred hearts mlm

As the leading florist in West Michigan, it is our mission to take your vision, and passionately create an authentic, customized experience that will make a lasting impression on the hearts and minds of your guests for many years to come.

Now the Lord said to Abram, "Go from your country and your kindred and your father's house to the land that I will show you. And I will make of you a great nation, and I will bless you and make your name great, so that you will be a blessing...

Over time, the two kindred spirits found common ground and eventually, fell in love. Killian was there long before Emma, but once they both were all in on their relationship, there was nothing that was going to break them apart.

Linkage analysis of ten Utah kindreds and one Texas kindred withmultiple cases of cutaneous malignant melanoma (CMM) provided evidence that alocus for familial melanoma susceptibility is in the chromosomal region9p13-p22. The genetic markers analyzed reside in a candidate region onchromosome 9p21, previously implicated by the presence of homozygousdeletions in melanoma tumors and by the presence of a germline deletion in anindividual with eight independent melanomas. Multipoint linkage analysis wasperformed between the familial melanoma susceptibility locus (MLM) and twoshort tandem repeat markers, D9S126 and the interferon-[unkeyable] (IFNA)gene, which reside in the region of somatic loss in melanoma tumors. Ananalysis incorporating a partially penetrant dominant melanoma susceptibilitylocus places MLM near IFNA and D9S 126 with a maximum location score of12.71. Therefore, the region frequently deleted in melanoma tumors on 9p21presumably contains a locus that plays a critical role in predisposition tofamilial melanoma.

Several different studies have pinpointed a region on the shortarm of chromosome 9 (9p) as one involved in the early stage development ofmelanoma tumors. In an attempt to determine whether the region contained afamilial melanoma susceptibility locus (MLM), we examined genetic markers inthe candidate region for genetic linkage with MLM using 11 kindreds withmultiple cases of invasive CMM. Although the value of linkage studies inlocalizing homogeneous, fully penetrant dominant disorders has beenestablished [4], the value of such studies in more complex disorders isunclear. The mode of inheritance of familial melanoma has not beenestablished; investigators continue to debate the existence of a major gene,the localization of this putative gene, and the relationship between familialmelanoma and an associated trait, the dysplastic nevus syndrome (DNS) [5].However, given chromosome 9p21 as a candidate region, we analyzed geneticmarkers from this region in these kindreds with a partially penetrantdominant genetic model and localized a susceptibility locus for familialmelanoma.

In this study, 11 extended kindreds with 82 cases of melanomadiagnosed between the ages of 12 and 93 were analyzed. Each kindred iscaucasian and of Northern European ancestry. Ten of the kindreds are fromUtah (Fig. 1); one (K3346) is from Texas and has been studied for over 20years [6]. The kindreds were selected for the presence of melanomas inclosely related individuals. The study was approved by the InstitutionalReview Board of the University of Utah Medical Center and informed consentwas obtained from each participant. Histologic confirmation of invasivecutaneous malignant malanoma was obtained for all cases except for three thatoccurred in the early generations. Individuals in the kindreds with othertypes of proliferative melanocytic lesions, for example lentigo malignamelanoma (one case), melanoma in situ (two cases), ocular melanoma (onecase), and congenital melanoma (one case), were classified as unaffected forthe analysis. Table 1 presents the number of melanoma cases, median age atdiagnosis, and number of individuals sampled for each kindred. The melanomasdiagnosed in these individuals did not differ significantly in terms of ageof diagnosis or six from all Utah melanoma cases diagnosed between 1981 and1990.

To test for an inherited familial melanoma susceptibility, we usedtwo polymorphic short tandem repeat markers from the critical region of 9p,IFNA [17] and the D9S126 locus [10]. Primer sequences for the IFNA markerwere: TGCGCGTTAAGTTAATTGGTT and GTAAGGTGGAAACCCCCACT. Primer sequences forthe marker D9S126 were: ATTGAAACTCTGCTGAATTTTCTG and CAACTCCTCTTGGGAACTGC.Allele frequencies were estimated from the observed or implied genotypes ofthe set of founder individuals marrying into each of the kindreds; 55chromosomes were available for allele frequency estimates for each marker.Alleles not observed in founders were assigned an allele frequency of 0.01,with other frequencies adjusted slightly to allow gene frequencies to sum to1.0. Six alleles were observed for IFNA with frequencies of 0.01, 0.16,0.55, 0.07, 0.19, and 0.02 from the longest to shortest repeat. Five alleleswere observed for D9S126 with frequencies of 0.07, 0.02, 0.45, 0.05, and 0.40from the longest to shortest repeat. The frequencies for IFNA are comparableto those estimated from a set of 67 unrelated North Americans and Centred'Etude du Polymorphisme Humain (CEPH) parents, in which only the fivelongest alleles were observed; the D9S126 frequencies are comparable to thoseestimated in an Australian study [18]. The PCR reactions were done using astandard protocol [19].

The statistical analysis for the inheritance of susceptibility tomelanoma used three approaches. Because no adequate models exist for theinheritance of melanoma, certain assumptions were made. The first approach,an age-specific model, assumed a rare autosomal dominant susceptibilitylocus, incorporated age-specific penetrances for melanoma, and allowed forsporadic cases of melanoma (cases not due to the hypothesized gene) in thesekindreds. Five percent of all melanoma cases were assumed to be due to thehypothesized susceptibility; this estimate is similar to population-basedestimates of familiality for breast cancer, another common cancer withrecognized familial susceptibilities [20]. A relative risk to first degreerelatives of 2.5 was used, and was based on an estimate from a survey ofpublished data [21]. The age-specific model is a general model integratingage specificity and both predisposed and sporadic cases; however, because theparameters used are estimates only, other less specific models were alsoexamined.

The affected-only model lod scores suggested a maximum likelihoodlocation of MLM at a recombination fraction of 0.05 for IFNA with a lod scoreof 9.50, and a recombination fraction of 0.05 for D9S126 with a lod score of4.00. For the kindreds that appear to be linked to 9p, the affected-onlyanalysis gave essentially the same results as the age-specific analysis. Asubset of the families with slightly negative lod scores in the age-specificanalysis showed substantially stronger evidence against linkage in theaffected-only analysis. A higher recombination fraction is estimated usingthe affected-only model, due to the assumption of no sporadic cases ofmelanoma. The lod scores were insensitive to increasing rare allelefrequencies for the marker loci.

The genetic heterogeneity of IFNA and D9S126 linkage to MLM wastested with the admixture test as implemented in the HOMOG program [25]. Nostatistically significant evidence of heterogeneity was found for eithermarker for either genetic model. Two of the 11 kindreds showed stronglinkage to 9p13-p22, with multipoint location scores greater than 3 at themost likely location in each kindred under both models (K1771 and K3346).Three other kindreds were suggestive of linkage to this region (K3137, K1764,and K3012), with location scores ranging from 0.64 to 1.90. The remainingkindreds were largely uninformative under the age-specific model. Nosignificant heterogeneity was identified using multilocus location scores.

Melanoma susceptibility has been associated with DNS since itsfirst description in 1978 [26]. A number of families with multiple melanomacases were analyzed for segregation [27]. Members of the families weredefined to have melanoma, DNS, or both, or were considered normal. Althoughsegregation analysis did not reject a Mendelian dominant model for melanomaalone, the analysis of melanoma and DNS together did not conform to aMendelian dominant model. Pathologists also disagree on the diagnosis ofdysplasia in nevi. The NIH consensus development conference on melanoma [28]suggested that the diagnosis of dysplastic nevus is ambiguous and should notbe used. Our studies of nevi in Utah kindreds suggest that a quantitativetrait based on number and size of nevi is inherited as a common codominantmajor locus in some kindreds [29]. CMM/DNS data studies consistentlyrejected rare dominant inheritance as a model for DNS [5, 30]. Because thenumber of nevi could be associated with melanoma risk [31], total number ofnevi is also being examined as a melanoma-associated phenotype [5, 29].

As family data from a large number of populations becomeavailable, the nature of the genetic predisposition to melanoma will begin toemerge. The existence of genetic heterogeneity may be suggested by kindredsexhibiting lack of 9p linkage; however, heterogeneity is confounded by thepresence of sporadic cases and could be difficult to assess in smallkindreds. Analysis is further complicated by tenfold differences infrequencies of CMM in caucasian populations of Nothern European origin withdifferent degrees of sun exposure [36]. Genetic heterogeneity will only beresolved by the confirmation of linkage to other chromosomes. To datestudies that exclude 9p linkage and support 1p linkage are based on a complexand controversial phenotype (CMM and DNS) and their analysis should berepeated using invasive melanoma as the phenotype [32-35]. Independentstudies are also needed to examine the relationship of the MLM locus toprecursor nevus phenotypes and to assess the interaction of the MLM locuswith known environmental risk factors. The ultimate identification of thegermline mutations within the gene will allow estimation of the proportion ofmelanoma kindreds that are due to changes at the 9p locus, the frequency ofthe disease allele, and age- and sex-specific penetrances.